Racism And Discrimination Today Essay

How would you like to be treated certainly because of your cultural, beliefs, tradition or even color? Well this is happening everywhere every day. This is called racial discrimination. So what is racial discrimination? It is not knowing anything about someone when you look at them, but disliking them anyway and treating them differently, not because of who they are, but what they are. In addition Racism started from the past and is still active today. Racism in the past was simply violent especially in the early 20th Century. When slavery was ended in America in 1865 racial tension occurred. As the free slaves, where allowed to move freely around the land a majority of the white population still saw them as slaves and did not want to interact and socialize with them. One example of racism is that Research has shown that teachers expect black children to fail Not only are black children played in lower sets; they themselves believe that they are certain to fail. This is proof that racism is every where and occurs from any age group. Racism has always been around. It is one of the world’s MAJOR concerns TODAY. A number of people are naà ¯ve of how much racism undertakes in our society today. Racism can be seen in incidents of racist abuse, harassment and discrimination. Racism is the discrimination of a person because of the race that they have inherited. Racism can be said to anyone. It is certainly severe that these things change, but these past few years, many people in all countries have been saying malicious and discourteous things about one another’s tradition. I can’t stress to say that racism is harassment, it is Mistreatment. People think it’s amusing to torment a person because of their color, their accent, culture and sometimes even how they are not good in something, this is all racism. There are numerous diverse types of racism, for example racism because of skin color, birth place, religion etc but they all got a couple of things in common. All kinds of racism are dreadful and create a negative and sometimes dangerous emotional response. Racism not only leads to social problems but in severe cases it causes mental illness and violence for example self harm, depression and the harming of others. In most cases it causes the target to feel deserted, depressed and livid as most of you people previously know from experience but what you people didn’t is that in the most severe cases racism leads to suicidal thoughts and the miserable thing is that in the worst cases these thoughts are carried out and its usually by a young teenager. That’s a young person with their whole life ahead of them claiming their life because a few people can’t accept them because they are a little different. Many riots have been caused all around the world due to racism. As John F. Kennedy had said† This nation was founded by men of many nations and backgrounds, on the principle that all men were created equal.† A statement which directly states the importance everyone has in this world and the equality everyone shares regardless where you are from or what color you are. Racism is always going to occur but their will always be a chance to reduce it. Truth speaking there are no different races, but only one race. The human race. Thank you for listening!

John adams

John Adams had more positive characteristics than negative. John Adams of Brainteaser Massachusetts was a lawyer, farmer, Harvard graduate, husband of Abigail Smith Adams, father of four children, and a revolutionary. By the look of things, he seemed Like a pretty lovable man considering he was his wife's tenderness of husbands and her good man. He had many great qualities that everyone around him would appreciate his presence. As for the negative traits, he was fiercely stubborn and quick to anger. 2)John Adams thought his biggest flaw was his tendency to talk too much.When he was twenty years old, he worried over never having any bright ideas, or being too bright for his own good and show off to others who would befriend him. He hated that he was overly proud and conceited and wanted to change that about himself. 3) Abigail Adams had views on nearly everything and people. She was always quick to express what she was thinking. She was an independent woman who took responsibility of all her duties as a wife and a mother. She had the positive quality of being such a loving and caring wife, and made John Adams' life Infinitely fuller. It's almost as If she was the missing piece to his puzzle.His marriage to Abigail was the most Important decision of his life. 4) John Adams was asked to defend the soldiers and their captain when they came to trial. He was informed that no one else would take the case, but he accepted regardless what judgment he would soon be getting. He said that no man in a free country should be denied the right to counsel and a fair trial, and convinced, on principle, that the case was of utmost importance. He put law above his personal beliefs and knew it was his duty to accept the case. Eventually, his fellow patriots came to respect him for what he had done. John Adams said, â€Å"Facts are stubborn things; and whatever may be our wishes, our inclinations, or the dictates of our passion, they cannot alter the state of facts and evidence. â €  He said this during his successful defense of the British soldiers who fired upon the crowd during the Boston Massacre. His actions to represent the British soldiers proved that despite all differences, men of principle can act Justly under the rule of law. This statement about facts, like many truths, Is universal and teaches that we must face truths, even when we don't Like them. 6) Briefly describe each of the followingGeorge Washington: Commander of Virginia militia, Continental arrant commander in chief during Revolutionary War, first president James Otis: Also a leader with John Adams of a new generation of political activist, a group called Sons of Liberty. The Sons of Liberty united otherwise adversary groups taking opposition to the Stamp Act to the streets, organizing riots and intimidating tax collectors. Sam Adams: Ben Franklin: Philadelphia first citizen, the most famous American alive, printer, establishing the American philosophical Society resulting in Philadel phia becoming he recognized center of American thought and ideas.Thomas Jefferson: Be]main Rush: John Dickinson: 7) Describe the role Adams played in each of the following: Boston Massacre: March 5th. Stamp Act: Last week of May 1765, Starting in November, nearly everything written or printed on paper other than private correspondence and books were required to carry revenue stamps. This helped pay for the cost of the French and Indian war and to meet the expense of maintaining a colonial military force to prevent Indian wars. Adams remained cautious with his involvement in political activities involving the Stamp Act.He was worried that this might hurt his reputation. This Act marks the beginning of the struggle for freedom and independence. His involvement started in August 1765 when he published an essay in the Boston Gazette entitled â€Å"A Dissertation on Canon and Feudal LaW'. The Stamp Act was hardly mentioned, however it discussed British Law and how certain liberties and freedom Americans enjoyed was earned by many generations of Americans.

Black Cinema - Carmen Jones Essay Example | Topics and Well Written Essays - 500 words

Black Cinema - Carmen Jones - Essay Example She was compared to another tragic Hollywood heroine, Marilyn Monroe-so glamorous was her image and turbulent was her life. â€Å"In 1954, she won the lead role in the movie that would make her a star-Carmen Jones- a lavish musical based on the nineteenth-century French opera Carmen by Georges Bizet that tells the story of a beautiful but fickle gypsy girl whose seductive ways lead to tragedy.† (Carmen Jones....) This role came to her lot on the basis of her sex-appeal. When she was not selected in her first audition, she practiced the intended role to perfection with an authentic-sounding southern accent, her tight skirt and low-cut blouse exhibited her feminine assets, she tousled her hair, the make up was brilliant and the result was obvious. She made the perfect character and won the heart of the director personally as well, though the liaison ended on an unfortunate note. The movie was a stupendous commercial success, Dorothy became the toast of Hollywood, reporters, publishers, photographer vied with each other to describe this black sex-bomb, and Life Magazine described her as one of the most beautiful women in America. Love, passion, betrayal and tragedy marked Carmen Jones which is an adaptation of Bizets legendary opera, which Dorothy plays to perfection. Her extraordinary beauty, and tremendous sex appeal is the object of desire of many men. Carmen successfully traps an army officer, he succumbs to her physical charms and forsakes the sweetheart to whom he is engaged. In the 1950-1960s Hollywood was sill plagued with racism and no black-woman would think of securing the lead role. Minor domestic and subservient roles came to their lot. Notwithstanding the maiden success of Carmen Jones, the producers and studio bosses refused to accept African American actresses for roles other than domestic servants, tramps and seductresses. In such a situation, the lusty young woman Dorothy

Qualities that make an ideal friend Essay Example | Topics and Well Written Essays - 500 words

Qualities that make an ideal friend - Essay Example He would go the extra mile to make sure that we remain contented and satisfied with things that are happening with us. An ideal friend would take our family as theirs and thus would easily come in and go out of our house as and when needed. This ideal friend would not mind asking us what we have on our mind and secretly solve our problems. This ideal friend would give us company whenever we need it the most. This would mean that he would give his shoulder whenever we are down and hug us when we get heart-broken. This ideal friend would also help us financially when we go through a credit crunch. He would interact with our problems in such a way that problems will start getting solved in a quick manner. (Author Unknown, 2008) His linkage with our lives is immensely significant since the ideal friend is ideal for the very same reason. This ideal friend will capture our hearts with his humor and wit and would not less us get bored whenever we need good company and a lift from our social and professional problems. An ideal friend keeps people happy with him and does not indulge in useless gossip. He concerns his own self with the betterment of his own personality as well as of his friends. He concentrates on the aspect of ‘giving’ more than anything else. He is humble and remains very polite at the best of times. He does not give into pressure which is exerted upon his personality every now and so often. Indeed an ideal friend is ideal in all facets of life. In the end, an ideal friend possesses so many qualities that it seems pretty hard to list down all of them. Most of these qualities do not exist in one such person to which we can remark as being the most ideal one possible. Hence there is enough reason that there is no ideal friend in this world for us. We forget that we also have to become an ideal friend for an individual so that he could become as such. But then again

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Multimedia Assignment Example | Topics and Well Written Essays - 500 words

Multimedia - Assignment Example The company will also be happy to avail additional services and reference upon the client’s request. The company has a precise understanding of software development needs, and the company also has the skills, experience and knowledge to complete the project in a successful manner. The company is also recognized by the association of software companies within the state and has been placed on the map to show its competency. The company shall be involved in developing the system from the start and customize it according to NPC needs that will make the system easy to use even minus technical support. Once agreed, the development phase takes off and a prototype is availed for demo is when NPC commits a down payment. After complete system development, the company shall offer training to the staff members and be available for any technical support that may be needed. NPC shall use the system for a period of three months for convenience purpose is when the final payment is made. IMS shall avail free consultancy service to the NPC for a period of six months from the time of system delivery. The system contains a home screen that can be viewed by both site visitors and staff members. The home screen has a login area that can be used by staff members while logging into the system. The clients can place orders and at the same time seek for vet services. A good system is supposed to be easily navigable by any type of user; hence the system should be simple to understand (Eurospi 2007, & Abrahamsson, 2007). This can be achieved by use of few pages to avoid mix up. The system uses a well-organized database that enables retrieval to be easy and secure. For security reasons, a back server is set on the cloud. Cloud computing is taking technology miles away and most tech companies prefer using cloud for the purpose of storing data and can be retrieved in case the primary storage fails at some pint. The main page is

Film Analysis of final sequence in Se7en Essay Example | Topics and Well Written Essays - 2000 words

Film Analysis of final sequence in Se7en - Essay Example While Mills is controlling Doe at gunpoint, Doe talks about how much he admires Mills, but does not explain why. Somerset opens the box and shrinks back in horror at the scene of the contents in the box. He runs back to advise Mills not to pay attention to Doe, but the murderer discloses that the box has Mills wife’s head. Informing that he had bought information about Mills by pretending as a tabloid reporter, Doe declares that he symbolize the sin of "Envy" as he was envious of Mills ordinary life, and murdered Tracy after unable to "play husband" with her. He then torments the distressed Mills with the information that Tracy was expecting. Somerset is powerless to control Mills as he empties his gun into Doe, becoming the incarnation of "Wrath". After a  highly shaken and dazed Mills is taken away, Somerset is asked where he will be to which he answers, "around". The most significant scene in the clip is when Doe is inciting Mills and at the same time Somerset is trying t o reason with Mills. The two distinct but overlapping voices are playing in the background and finally Mills shoots Doe. Narrative Function - The last scene brings out the remaining two sin and two bodies as told by Doe to the police. The last scene connects the dot or clues which were spread over the entire movie. Doe craves for a normal life yet feels he has to do his duty of punishing the sinners. He sees that Mills is short tempered. Doe feels he himself is a sinner as he is envious of Mills’ life. The last scene shows three people behaving completely different from one another. The sequence makes it clear to the audience why Doe turned himself in. The sequence brings out very clearly the three different personalities. Here it is seen that Mills is an emotional person while Somerset is more stable and logical. Even in dire and extreme situations Somerset chooses to think and act. Doe on the other hand is clearly shown as the patient person, who

In pregnant patients, does the use cabbage leaves decrease the Research Paper

In pregnant patients, does the use cabbage leaves decrease the incidence of breast engorgment as well as the application of brea - Research Paper Example However, this paper intends to analyze the effectiveness of swift nursing interventions along adequate patient teaching in relieving engorgement compared to the use of binders. After the comparison, the paper will highlight the best alternative for relieving engorgement. Research Question The research question in this case was to analyze whether the swift action from nurses in offering support pregnant patients before and immediately after delivery can help them in handling engorgement. On the other hand, the paper will analyze the efficiency of breast binders in minimizing the pain brought about by the condition. Mothers face a lot of anxiety after birth, and often need reassurance from informed nurses that they can handle the breastfeeding experience. The action from nurses also involves highlighting the crucial breastfeeding tips to mothers. Therefore, the intervention from nurses must come along adequate patient teaching. This research seeks to examine whether both medical and no n-medical support from nurses is more efficient in reducing breast engorgement in comparison to the advocated use of breast binders. The Search Process The EBSCO database proved to be a reliable source because it provides a wide range of resources. However, it was essential to customize the advanced search settings in order to get access to the most relevant range of articles. Therefore, limits for results included full text research articles, peer reviewed and from journals. Moreover, other limits included customizing the geographical setting to United States of America and limiting the search to articles dated 2007 to 2012. The search words were ‘breast engorgement’. Numerous articles addressing this issue appeared. Among these articles, five proved relevant to the issue and served as reliable sources for this search. The use of CINAHL database proved very resourceful because of the vast collection of nursing articles from renowned journals. How Engorgement Results In the first few days after birth when the baby begins to breastfeed, the milk may not flow easily. In this initial phase of the breastfeeding process, colostrum flows out to supply the baby with both nutritional and immunological components. However, its flow presents irregularities. At first, the mother may not succeed to feed the baby despite her efforts. However, with time the milk may flow to the breast in large amounts. The sudden inflow may cause the breast to swell and become tender. For many mothers, the breastfeeding experience ranging from the anxieties to the pain of engorgement may prove unbearable. Strong (2011) highlights that the pain of engorgement may extend for the initial six days under normal cases, but pain occurring beyond the first week of breastfeeding has other causes. A pregnant patient will require this knowledge prior to delivery. Critical understanding of the causes and remedies of engorgement is an important aspect to each pregnant patient. The pregnant patient requires relevant information concerning the implications of both natural birth and caesarian option concerning engorgement. Nurse Interventions and Adequate Patient Teaching According to Martucci (2012), the entire procedure of initiating breastfeeding can be a lot easier if nurses present the mothers with relevant informat

J.B Priestly's An Inspector Calls Essay Example | Topics and Well Written Essays - 1000 words

J.B Priestly's An Inspector Calls - Essay Example Priestly uses a number of dramatic devices to express these ideas, among others, to the audience, whilst still keeping them involved and interested in the plot. This play is very tightly structured as Priestly wanted to achieve a very quick and smooth running play where all the parts seemed to fit into one another. Therefore all the action takes place in the dining room and even when there is a break between acts the start of the next act takes us to the same point in time at which we had left the action. The play is structured as a series of episodes in which the focus is mainly on one particular character. In this way a picture is gradually built up of all the main characters in the play. The Play, 'An Inspector Calls' is all about the mystery surrounding the suicidal death of Eva Smith, a worker, and the moral values of a superior social class family, The Birlings. Each member of the Birling family has had a connection to the dead girl. No one has directly caused her death, nor even wished her dead, yet everyone present has contributed in some way to her demise. Patriarch Arthur Birling started it all when he fired the girl from his factory, but all the other family members contributed in their own ways to Eva's downfall. Birling's wife Sybil, future son-in-law Gerald Croft, son Eric and daughter Sheila: All contributed, independently of one another and without a second thought or remorse to Eva's demise. How is Tension created in the Play: During Act one, the playwright uses a lot of dramatic devices to change our opinions of the Birlings. We start off feeling happy for the Birlings as Shelia and Gerald are getting married. It is all quite relaxed but with the use of dramatic irony we start to think that actually the Birlings are quite foolish, stuck up and self obsessed, especially the character of Mr.Birling. The methods that Priestly uses to interest and involve the audience are the use of dramatic irony, tension and building up the story in chronological order, meaning he builds up the story in order, one person after another, in order of the times people that met Eva Smith which always keeps the audience on their toes. The build up of tension keeps the audience guessing, wondering who is involved in the death and who is really to blame. The use of dramatic irony is a key point to the play and without it Priestly wouldn't be able to get his point across. Priestly used the Lighting effects to cast a symbolic and expressive feel of the characters. This is reflected when the lights focus .Pink and intimate, until the inspector arrives. The pink and intimate setting/lighting show the relaxation the characters are feeling. Everyone is happy and there is romance in the air for Shelia and Gerald. But when the inspector arrives, the lighting changes from pink to hard and bright. This type of lighting wakes up the audience and shows something is about to happen. It is almost like an interrogation, being under the bright spotlight, it makes the audience

Source Analysis Assignment Essay Example | Topics and Well Written Essays - 500 words

Source Analysis Assignment - Essay Example Different decisions are necessary before making a bible interpretation such as allegory in which the reader must look beneath the surface of the text to get the real meaning. Reading the accounts of creation in genesis chapter 1 and 2 requires one to understand the deeper meaning of the text and avoid literal reading (Aageson, 2000). The message by the author of this reading is that the bible requires an in-depth reading to understand the actual meaning of its contents. Literal reading will not give a perfect interpretation of what the bible contains, as the language is figurative. All biblical material such an epistle, prophecies, apocalypse, and fable require the reader to make an accurate meaning of the word before making any interpretation. According to the author, historical facts need to have meaning, significance, and some biblical claims such as the death of Jesus on the cross for human redemption. Jesus death on the cross is a historical fact, but the argument that his death was meant to save the world from third sins does not have historical evidence. Evaluation of the truth concerning the bible material is not possible except by using the truth by definition. for instance, the statement "Jesus is God" (Aageson, 2000). The state can be taken as truth by definition and cannot be verified. Some of the biblical myths are mainly the Israelites ideas of covenant especially the Devine promise of land such as Canaan. Therefore, many biblical themes and stories fall under the mythical category rather than the truth and anything concerning God’s creation and his dominion over the world are all myths. The author gives critical contents of the bible to those that think that the bible has more hidden meaning and require critical analysis to establish the truth. According to the author, literal reading of the bible will not elaborate the statements or give the actual meaning to th ose who need a serious interpretation of the

The significance of conflict Essay Example for Free

The significance of conflict Essay In the Kite Runner, conflict is evident throughout; physical conflict of the war, Baba’s internal fight against cancer, Hassan’s constant battle with the society he lived in, Sohrab’s struggle to accept and trust Amir, but none more prominent than Amir’s conflict with his emotions and his own image of himself. The entirety of Hosseini’s novel is based around the self-conscious narrative of a guilty man who struggles to come to terms with the consequences of the, decisively wrong, decisions he made as a child, which seems to have caused a domino effect on his whole life, never truly able to make the right choice until the end of the novel when he finally chose to stand up and stand up for what is right instead of running and hiding- saving the last ounce of his brothers happiness, his son, Sohrab. The very first line of the novel is suggestive of Amir’s inner turmoil, â€Å"I became what I am today at the age of twelve†, as it gives the impression that he doesn’t even think himself to deserve being thought of as human, but rather prefers to be looked at as some sort of creature, incapable of acting in a humane manner, through the authors choice for the narrator to use the word â€Å"what†, rather than â€Å"who†, in the hopes of making us dislike the narrator, as he does himself. This emotional havoc that he faces effects the resolution of the story, as the crushing remorse that he has carried with him since he was twelve years old, propelled him forward, so he could finally begin to unload some of it after having done a good deed, his actions pleading for forgiveness from all he has hurt, especially Hassan, his friend and brother. Robert Browning’s ‘The Laboratory’ is a poem about the conflicted emotions of a woman who wishes to punish those who have hurt her, seeming to be very enthusiastic about the crime she was about to commit, though her confidence can be used to mask the way she was desperately trying to fight her conflicted emotions away. In my opinion, the female narrator in this poem is trying desperately to hide the fact that she is undoubtedly terrified of the reality of what she was doing, which is shown in the way Browning writes â€Å"He  is with her, and they know that I know†- the simplistic, monosyllabic structure of this line suggests that the narrator feels that she must remind herself of the thing that her driven her to act in such a way, fuelling her anger so she was able to complete the task with no remorse. As the poem begins in medias res, we aren’t entirely sure of the events that occurred that were able to drive her to such a point, in which she had contemplated taking another person’s life, but we do know that it was these occurrences that caused the confusing mix of feelings that swarmed her mind and affected the resolution of the poem. Her confusion seems to be a result of the narrators need for some sort of revenge, to soothe her pain, heartbreak and humiliation combined with sorrow, as she seems to believe the affair was entirely her partner’s mistress’s fault as she was said to have â€Å"ensnared him†, still loving her companion dearly. This anger pushed her forwards into doing something she wasn’t entirely comfortable in doing, her anxiousness being repeatedly shown throughout the poem in her curiosity, for example â€Å"is that poison too?†, yet she completes the task she set out to so as to punish those she felt necessary. In The Patriot, one of the types of conflict experienced by the narrator would be an internal battle over whether he truly considered himself to be guilty of the crime they were punishing him for. It is suggested throughout the poem, that the narrator is a man who has fallen from grace, after having been considered a God-like figure that everybody respected and looked to for guidance, but failed to provide it, even though he tried his best. For example, a quote from the poem says â€Å"it was I who leaped at the sun to give it to my loving friends to keep†, giving the impression that he really did try to give the best to the people of the town as he cared for them all, considering them as his closest friends, and is trying to convince the reader that he is not guilty, pleading innocence, as the only crime he had committed was being human, and making a mistake. His own opposition to this argument, however, is underlying all of his words, in the repetitive and never changing rhyme scheme, which is indicative of his resignation and acceptance of his fate, choosing unconsciously not to argue with what the people were doing to him, because he, in some ways, agrees with what they are doing as, though he doesn’t feel guilty of the things they say he did,  he feels responsible for his actions causing so much trouble. This affects the resolution of the story as the narrator seemingly allows the people do whatever they please, choosing to surrender without a fight, glad to be gone in the end as he feels he would be safer with God- â€Å"God shall repay: I am safer so.† In Browning’s ‘The Pied Piper of Hamelin’, there is a more overt physical conflict between two of the main characters of the poem; the mayor and the pied piper. The resolution of the poem was affected by a dispute over an issue of pride and money. The piper was a very proud man, who was well aware of his capabilities and wanted to ensure everyone who knew him, knew that he was their hero, believing he deserved some sort of recognition for his talents, in a rather arrogant manner as he is seen to boast to anyone who will listen about the challenges he had already faced, and those he planned to face, in his ‘career’- â€Å"having left, in the Caliph’s kitchen, Of a nest of scorpions no survivor†, choosing to name drop, to show how impressive he was thought to be. The selfish nature of the mayor is portrayed in the way that he is said to have spent the taxes of the townspeople on â€Å"gowns lines with ermine† for himself and the rest of his â€Å"corporation†, when the town was writhing in rats that were wreaking havoc in everyone’s daily lives. This clash of personalities affected the resolution of the poem greatly as, had the mayor not been so completely concerned with his own wellbeing over that of the town he was supposed to be looking after, and paid what the pied piper was promised and deserving of (â€Å"A thousand guilders! Come take fifty†), the piper would not have been angered and humiliated, and so, would not have resulted in the capturing of the children of the town.

History of Marco Polo

History of Marco Polo The Travels of Marco Polo MarcoPolo was born in 1254 when Italy was split into fighting city states. Thirteenth century Europe saw a huge increase in geographical knowledge and anincrease in trade with the Far East and Western Europe. One country that had the Europeans fascinated was China and they all wanted to establish trade andtravel there. Contact with the Far East was established by such men as Giovanni da Pian del Carpini and William of Rubrouck who were sent by Louis IX of France, which happened before the Tartar conquest of Asia Minor and the beginning of Tartar embassies in the West by the late thirteenth century. Routes of trade and opportunities that existed during Roman rule were reopened. Niccolo Polo and Maffeo Polo, the father and uncle of young Marco Polo, left him behind and set off for an epic journey eastward towards the court of the khan of the Pipchak Tartars at Serai. The brothers Niccolo and Maffeo stayed there for over a year while collecting asignificant profit. The brothers decided to return to Venice, but they found that their path was cut off by local wars. So the brothers made the decision to go to the great khan of China. They arrived in Beijing and were received very graciously by the great khan. After doing business there, the khan wanted toknow about the Christian life and told them to go b ack to Venice to see the Pope and return with Christian missionaries for the education of the royal court. The great khan also wanted them to return through Jerusalem with Holy Oil from the lamp which was kept burning over the Sepulchre of our Lord Jesus Christ. To help their journey, the brothers were given the service of a Tartar guide and anything they needed in Tartar territory. Aftera long and treacherous journey on land to Venice, Niccolo and Maffeo made it in1268 and found that Pope Clement IV had recently died and no successor had been elected. Gregory X was elected the new Pope, and in 1271, Maffeo and Niccolo managed to secure the services of two inept Dominicans who would soon decide to desert the mission. The Polos went back to Beijing anyway, this time taking with them Marco, the teenage son of Niccolo Polo, who would become one of the most traveled people in the world. Marco, his father Niccolo, and his uncle Maffeo began their journey by sea to Acre in 1271. They arrived at the mouth of the Persian Gulf and decided to not travel by sea but to turn north and follow the ancient caravan routes through Iraq and Persia. The Polos went through Turkmenistan and Persia until they hit the Oxus River (now called the Amu Darya). They traveled across the plain of Pamir and crossed the desolate Gobi Desert where they then made it to the mercantile cities of Samarqand, Yarkant (Shache), and Kashgar (Kashi). Located in the northwest partof China, they reached Tangut. After a very long journey, the three Polos were made welcome at Shangdu the summer capital of the Mongol emperor Kublai Khan in 1275. Marco, the youngest Polo, soon became a favorite in the Chinese court ofthe Great Kublai Khan. After studying and becoming fluent in the native languages, Marco Polo became a commissioner in the Mongol government in 1277. Kublai Khan trusted the Venetian Marco Polo so much that he relied on his advice in many important affairs. The descriptions Marco Polo gave of the emperors palace fired the imaginations of generations of explorers andtravelers, all of whom wished to view for themselves the eight square miles of enclosed barracks, parade grounds, vast arsenals, storerooms, living quarters, library, and especially the treasury. As a trusted agent of Kublai Khan for seventeen years, Marco Polo had a very unique opportunity to see a developed and sophisticated way of life not seen by Western culture. Kublai Khan trusted Marco Polo so much that he made him governor of Yangzhou. Marco Polo visited nearly every part of both northern and southern China in his long and loyal service to the great khan, using the imperial horse andpacket-boat system that was kept in readiness for the comfort of governmentofficials. Marco Polo was kept in constant service of the khan by cataloging and describing in detail many huge cities, provinces, and major commercial towns. He was interested in everything, including the manufacturing arts, commerce, architecture, the residents in each area, and many other things. Marco Polo was very impressed and intrigued by the silk industry and the book contains an excellent early picture of silk culture, weaving, dying, and finishing. The treasures of the Chinese cities must have seemed unreal to thirteenth century Europe. Marco Polos description of Hangzhou included the fabled twelve thousand bridges of the city, its many huge markets and bazaars, its cavernous warehouses for its trade with India, and even its consumption of six tons of p epper a day. Marco Polo also visited India on business and in the same great detail recorded its commercial life. He also may have visited the steppes of Asia, or the original land of the Moguls, where Kublai Khans ancestors may have grazed their herds. Even though it is very doubtful that he traveled so far north, it may have been possible that the Venetian made it to Siberia. His accounts of his many journeys also indicate great interest towards the islands south of China, including the Philippines. Around 1292, the three Polos desired to return to their home, but they were so favored that Kublai Khan would not let them leave. It was very hard for him to let them leave, but in reluctance he permitted them to go withan official commission to take the Mogul princes daughter to her wedding in Persia. It took them three years to return home even though they primarily traveled by ship. On the way Marco Polo recorded his impressions of Java also know as the great island, and many other places like Madagascar, Zanzibar, Sri Lanka, Dragoian. They crossed the Red Sea and the adventurers finally reached Venice in 1295. Their extraordinary odyssey that lasted nearly twenty years finally came to an end.   Whent he Polos arrived to their old home their family that was staying there had presumed them dead and didnt believe it was they and would not let them in the house. After some arguing, the Polos convinced them that they really were who they said and their relatives allowed them in. Then Marco Polo was captured by the warring Genoese and imprisoned. While he was in prison, he dictated his experiences to prisoner and writer Rustichello of Pisa. The book was called Divisamentdou monde, later turned into The Travels of Marco Polo, 1579. Marco Polos uncle and father fell into the background and the young Marco Polo became the main figure. The great and in detail story was very readable and made a huge impression on Europe. The book was received in awe and it was not fully believed until other travelers to China verified parts of the tale. Christopher Columbus may have been stimulated to travel by this book and maybe many other famous explorers. Marco Polos account of his travels in Asia was one of the primary sources for the European image of Far East until the late nineteenth century.

Automatic Number Pate Recognition System Information Technology Essay

Automatic Number Pate Recognition System Information Technology Essay Automatic number pate recognition system is a mass surveillance method that uses optical character recognition on images to read the license plates on vehicles. System might scan number plates at around one per second on cars traveling up to 100mph(160 km/h).they can use existing closed -circuit television or road-rule enforcement cameras, or ones specifically designed for the task. They are used by various police forces and as a method of electronic toll collection on pay-per-use roads and monitoring traffic activity, such as red light adherence in an intersection. ANPR can be used to store the images capture by the cameras as well as the text from the license plate, with some configurable to store a photograph of the driver. Systems commonly use infrared lighting to allow the camera to take the picture at any time of the day. A powerful flash is inclined in at least one version of the intersection-monitoring cameras, serving both to illuminate the picture and to make the offender aware of his or her mistake. ANPR technology tends to be region -specific, owing to pate variation from place to place. Some concerns about these systems have centered on privacy fears of government tracking citizens movements and media reports of misidentification and high error rates. However, as they have developed, the systems have become much more accurate and reliable. There is an increasing requirement to identify vehicles and track their location for a wide number of applications. These include: Congestion charging Several major cities around the world levy a charge a drive within them Car park management Using the number plate to identify the time of entry and departure of a Vehicle. Counter-terrorism Monitoring the arrival and departures of vehicles at major ports. Literature Review Our literature survey mainly focused on automatic number plate system research papers and its existing system along with its application, image processing technique and neural network recognition. These can be clearly illustrated as follows: Automatic number plate recognition system Javaanpr existing open source code in sourceforge.net Thesis describing research, image processing and neural networking technique along with its algorithm in pdf on javaanpr on sourceforge.net Image processing technique ImageJ -api based on java language for digital image processing Image editor -api based on java language made for image processing JAI api -java advance imaging for image processing from sunmicrosystem at java.sun.com. Opencv- Digital Image Processing (text book from library) Neural networking technique Introduction to java neural network second edition by jfheaton at heatonresearch.com Some ocr samples using neuralnetworking at sourcecode.com and its explanation Study on nepali ocr research conducted by madan puraskar guthi(yala Maya Kendra) Ocr sample developed by Google based for Linux available for windows on dot net (tesseract) Jooneengine-java api on neural network not so well developed and efficient at http://www.jooneworld.com Kohenen -java api on self organizing map applied to compress jpeg image. Somdemo-sample java program for illustration how self organizing map works. Program iterately train to converge with identical color from random samples Artificial neural network text book available at library (low price edition from pearson education. Neural networks systematic introduction by Raul Rojas(from lectures at free university at Berlin and later at the university of Halle) Automatic Number Pate Recognition system a)javaanpr Javaanpr open source available at sourceforge.net worked as prototype for building our Nepali automatic Nepali number plate recognition system. It also contain thesis in pdf format prescribing image processing technique and neural networking technique along with its algorithm. It works well recognizing foreign number plates contained as sample in the site. It was beautifully coded applying sophisticated and specialized algorithms for image processing and neural network technique. It also used xml files to save and retrieve neural network training data. Figure: sample javaanpr at sourceforge.net For more information-http://sourceforge.net Image processing Technique a)ImageJ 1.42 ImageJ was first developed on class files now available on GUI interface. User can just process image using various buttons and entries if prescription is required .programmers can develop own macros and plugins to achieve its intended function if required and compile there within and run the code. It is capable of processing both 2D and 3D interactive image processing. Figure. ImageJ graphical window interface For more information: http://rsb.info.nih.gov/ij/ b) Image editor Image editor was also found during search for image processing tool. It is also based on java language and available as java API, now class file are available with GUI interface easing its its manipulation. Image editor api seems inefficient and not so capable for our intended operation and not so much researched. C) JAI api the java advance imaging(JAI) API further extends the java platforms (including the java 2D API) by allowing sophisticated, high -performance image processing to be incorporated into java applets and applications.JAI is a set of classes providing imaging functionality beyond that of Java 2D and the Java Foundation classes, though it is compatible with those APIs. JAI implements a set of core image processing capabilities including image tiling, regions of interest, and deferred execution.JAI also offers a set of core image processing operators including many common point, area, and frequency-domain operators. JAI is intended to meet the needs of all imaging applications. The API is highly extensible, allowing new image processing operations to be added in such a way as to appear to be a native part of it. Thus, JAI benefits virtually all Java developers who want to incorporate imaging into their applets and applications. JAI features Cross-platform imaging Distributed Imaging Object-oriented API Flexible and Extensible Device Independent Powerful High Performance Interoperable Initially program coding was done in JAI Later it becomes little inefficient and we again go for another programming method. For further information-http://java.sun.com d) Digital Image processing (text book from library) e) Opencv The OpenCV implements a wide variety of tools for image interpretation. It is compatible with Intel ® Image Processing Library (IPL) that implements low-level operations on digital images. In spite of primitives such as binarization, filtering, image statistics, pyramids, OpenCV is mostly a high-level library implementing algorithms for calibration techniques (Camera Calibration), feature detection (Feature) and tracking (Optical Flow),shape analysis(Geometry, Contour Processing ),motion analysis (Motion Templates, Estimators ), 3D reconstruction (View Morphing),object segmentation and recognition (Histogram, Embedded Hidden Markov Models, Eigen Objects). The essential features of the library along with functionality and quality is performance. The algorithms are based on highly flexible data structures (Dynamic Data Structures) coupled with IPL data structures; more than a half of the functions have been assembler optimized taking advantage of Intel ® Architecture (Pentium ®MMXà ¢Ã¢â‚¬Å¾Ã‚ ¢,Pentium ® Pro, Pentium ®III, Pentium ®4). Why We Need OpenCV Library The OpenCV Library is a way of establishing an open source vision community that Will make better use of up-to-date opportunities to apply computer vision in the Growing PC environment. The software provides a set of image processing functions, As well as image and pattern analysis functions. The functions are optimized for Intel ® Architecture processors, and are particularly effective at taking advantage of MMX†ºÃ¢â‚¬ º Technology. The OpenCV Library has platform-independent interface and supplied with whole C Sources. OpenCV is open. Relation between Opens and Other Libraries OpenCV is designed to be used together with Intel ® Image Processing Library (IPL) And extends the latter functionality toward image and pattern analysis. Therefore, OpenCV shares the same image format (IplImage) with IPL. Also, OpenCV uses Intel ® Integrated Performance Primitives (IPP) on lower-level, if It can locate the IPP binaries on startup. IPP provides cross-platform interface to highly-optimized low-level functions that Perform domain-specific operations, particularly, image processing and computer Vision primitive operations. IPP exists on multiple platforms including IA32, IA64, And StrongARM. Source:-openCV reference manual.pdf Cmgui-wx-2(.net wrapper class) This openCV tool can be easily integrated with .net platform like c#, visual basic etc. Cmgui is an advanced 3D visualization software package with modeling capabilities.Cmgui is a part of CMISS, a mathematical modeling environment initially developed by the University of Auckland Bioengineering Institute.CMISS stands for Continuum Mechanics, Image analysis. Signal processing and System Identification. There are three major CMISS software packages. Broadly speaking the main areas each piece of software deals with are as follows: CM is used for computational modeling Unemap is used for signal acquisition and processing Cmgui is used for model visualization and manipulation For more information:-wiki/getting started with cmgui Neural Networking technique a) Introduction to java neural network by jeff heaton This book along with video lecture helped very much for us to understand neural networks and learn coding technique. It was published form Heaton research center and they have developed encog framework for neural network where programmer can build fast neural network prototype for fast testing and checking since easy and flexible. After parameters have been determined for best operation such as number of hidden layers and number of neurons in each layer coding can be done since it code will be inflexible for such modification. Book contained different chapters on various types of neural networks and also its application. Only first seven chapters are allowed to read online and rests are not. It provides all its source code on site which also helps in learning and testing. Same book is also available in c# language. For more information-http://heatonreasearch.com/ b) On the beginning of project research we also got OCR sample using neural network at sourcecode.com with explanation. It was written at c#, due to compiler problem I didnt stress here much. c) Nepali OCR For us it was good news and opportunity to study research on Nepali OCR conducted by madan puraskar guthi. Different research papers were available on the site along with image processing portion code used to fragment Nepali character Image written on java. It deals with problem issues and complexity faced on Nepali character like devnagari font. For more information -http:// d) OCR engine tessaract by Google This was used by Nepali OCR for its processing and it supports many languages like Hindi, Nepali, Urdu, arabi etc. we didnt research here much. Figure: segmented portion of Figure : Another segmented portion of For more information-make Google search for link d) joone engine joone engine as a api in hope for easy and efficient coding we consider but it seems unworthy for project work. For beginner liking to test some xor operations and similar may find at least satisfactory otherwise unworthy. For more information-http://www.jooneworld.com/docs/engine.html e)Kohenen This sample also seems beautiful in understanding self organizing map or kohenen network. Here it is used to compress jpeg image. It was programmed on seven packages. For more information-http: // f) som demo This sample tries to converge iteratively with similar colors from randomly scattered pixel colors based on Euclidean distance method. Figure: som before training Figure: som after training For more information-link available at reference http://www.ai-junkie.com/ann/som/ g) Artificial neural Network text book (library) h) Neural network systematic introduction (by Raul Rojas) This book is good for understanding neural network systematically and based on lectures at free university at Berlin and later at the University of Halle. For more introduction-reference at http://www.wikipedia.com/selforganisingmap Figure: sample kohenen neural network (3D kohenen feature map) Source: http://rfhs8012.fh-regensburg.de/~jfroehl/index.html Anpr system application around world Police enforcement Germany On 11 March 2008, the Federal Constitution Court of Germany ruled that the laws permitting the use of automated number plate recognition systems in Germany violated te right to privacy. Hungary Several Hungarian Auxiliary Police units use a system called Matrix Police in cooperation with the police. It consists of a portable computer equipped with a webcam that scans the stolen car database using automatic number plate recognition. The system is installed on the dashboard of selected patrol vehicles (PDA based handled versions exists as well) and is mainly used to control the license plate of parking cars, as the Auxiliary Police doesnt have the authority to order moving vehicles to stop. If a stolen is found, the formal police are informed. United Kingdom The UK has an extensive (ANPR) automatic number plate recognition CCTV network. Effectively, the police and security services track all car movements around the country and are able to track any car in close to real time. Vehicle movements are stored for 5 years in the National ANPR Data Centre to be analyzed for intelligence and to be used as evidence. USA In the USA, ANPR systems are more commonly referred to as LPR (License Plate Reader or License Plate Recognition) technology or ALPR (Automatic License Plate Reader/Recognition) technology. One of the biggest challenges with ALPR technology in the US is the accuracy of the Optical Character Recognition (OCR)-the actual identification of the characters on the license plate. From time to time, states will make significant changes in their license plate protocol that will affect OCR accuracy. They may add a character or add a new license plate design. ALPR systems must adapt to these changes quickly in order to be effective. In addition to the real-time processing of the license plate numbers, some ALPR systems in the US collect data at the time of each license plate capture .Data such as date and time stamps and GPS coordinates can be reviewed in relation to investigations and can help lead to critical breaks such as placing a suspect at a scene, witness identification, pattern recognition or the tracking of suspect individuals. Average Speed cameras Another use of ANPR in the UK, Italy and Dubai (UAE) is for speed cameras which work by tracking vehicles travel time between two fixed points ,and therefore calculate the average speed. These cameras are claimed to have an advantage over traditional speed cameras in maintaining steady legal speeds over extended distances, rather than encouraging heavy braking on approach to specific camera locations and subsequent acceleration back to illegal speeds. UK The longest stretch of average speed cameras in the UK is found on the A77 road in Scotland, with 30 miles (48 km) being monitored between Glasgow and Ayr. Italy In Italian highways has developed a monitoring system named Tutor covering more than 1244 km (2007). Further extensions will add 900 km before the end of 2008. The Tutor system is also able to intercept cars while changing lanes. Traffic control Many cities and district have developed traffic control systems to help the movement and flow of vehicles around the road network. This had topically involved looking at historical data, estimates, observations and statistics such as: Car park usage Pedestrian crossing usage Number of vehicles along a road Areas of low and high congestion Frequency, location and cause of road words The UK Company Traffic master has used ANPR since 1998 to estimate average traffic speeds on non-motorway roads without the results being skewed by local fluctuations caused by traffic lights and similar. The company now operates a network of over 4000 ANPR cameras ,but claims that only the four most central digits are identified , and no number plate data is retained. Electronic toll collection Ontarios 407 ETR highway uses a combination of ANPR and radio transponders to toll vehicles entering and exiting the road. Radio antennas are located at each junction and detect the transponders, logging the unique identify of each vehicle in much the same way as the ANPR system does. There are numerous other electronic toll collection networks which use combination of Radio frequency identification and ANPR. These include: Bridge pass for the Saint John Harbor Bridge in Saint John New Brunswick City link Eastlink in Melbourne, Australia Gateway Motorway and Logan Motorway, Brisbane , Australia Fast Trak in California ,United states Highway 6 in Israel Tunnels in Hong Kong etc Charge zones the London congestion charge The London congestion charge is an example of a system that charges motorists entering a payment area. Transport for London (TFL uses ANPR systems and charges motorists a daily fee of  £8 paid before 10pm if they enter, leave or move around within the congestion charge zone. Stockholm congestion tax In Stockholm, Sweden, ANPR is used for the congestion tax of cars driving into or out of the inner city must pay a charge, depending on the time of the day. Other uses ANPR systems may also be used for/by: Section control, to measure average vehicle speed over longer distances. Border crossings Fillings stations to log when a motorist drives away without paying for their fuel. A marketing tool to log patterns of use Traffic management systems, which determine traffic flow using the time it takes vehicles to pass two ANPR sites. Drive Through Customer Recognition, to automatically recognize customers based on their license plate and offer them their last selection, improving service to the customer To assist visitor management systems in recognizing guest vehicles. Circumvention Techniques (drawback) Vehicles owners have used a variety of techniques in an attempt to evade ANPR systems and road -rule enforcement cameras in general. These methods may be Increasing reflective properties of the lettering and so that system might no locate or produce high enough level of contrast to be able to read Use of plate cover or spray Use of dirt to smear their license plate or utilize covers to mask the plate ANPR imaging hardware The frontend of any Imaging hardware is image capturing device that is camera. Retroreflective camera returns the light back to the source and thus improves the contrast of the image. A camera that makes use of active infrared imaging (with a normal color filter over the lens and infrared illuminator next to it) benefits greatly from this as the infrared waves are reflected back from the plate. This is only possible on dedicated ANPR cameras, however, and so cameras used for other purposes must rely more heavily on the software capabilities. Figure: hardware components used in ANPR system Figure source-http://securityautomation.co.uk To avoid blurring it is ideal to have the shutter speed of a dedicated camera set to 1/1000th of a second. License plate capture cameras can now produce usable images from vehicles traveling at 120 mph (190 km/h).threshold angles of incidence between camera lens and license plate are also major consideration to avoid image distortion during installation. Manufacturers have developed tools to eliminate errors from the physical installation of license plate capture cameras. Research on down sampling character For neural network input character image is down sampled into matrix whose value is binary 1 or 0 according to Boolean property of character on matrix region. It showed that no of samples required is not fixed and it varies with thickness of font traced. Figure: down sampling image character o with 7*5 matrix Figure: downsampling same character image o (buffered) with 32 *35 matrix Research works on algorithms A new algorithm for character segmentation of license plate Character segmentation is an important step in License Plate Recognition (LPR) system. There are many difficulties in this step, such as the influence of image noise, plate frame, rivet, the space mark, and so on. This new algorithm presents character segmentation using Hough transformation and the prior knowledge in horizontal and vertical segmentation respectively. Furthermore, a new object enhancement technique is used for image preprocessing. The experimentation results show a good performance of this new segmentation algorithm. Algorithm (steps) Preprocessing Size normalization Determination of plate kind Object enhancement Horizontal segmentation using Hough transformation Vertical segmentation For more information:-a new algorithm for character segmentation of license plate.pdf an adaptive thresholding algorithm for the augmented reality toolkit It is well known that fixed global thresholds have adverse effects on the reliability of marker-based optical trackers under non-uniform lighting conditions. Mobile augmented reality applications, by their very nature, demand a certain level of robustness against varying external illumination from visual tracking algorithms currently AAR Toolkit depends on fixed-threshold image-binarization in order to detect candidate fiducials for further processing. In an effort to minimize tracking failure due to uniform shadows and reflections on a marker surface, a fast algorithm for selecting adaptive threshold values, based on the arithmetic mean of pixel intensities over a region-of- interest around candidate fiducials. Algorithm This works on a per-marker basis and evaluates the mean pixel luminance over a thresholding region-of -interest (ROI), which is defined as bounding rectangle around the markers axis -aligned corner vertices in screen space. If a marker has been detected in any given frame, its bounding rectangle will be used as thresholding -ROI prediction for successive frames. This method yields good thresholding level in practice, given sufficiently high video frame rates. Fig.1.reflection off a markers surface with adaptive thresholding (upper) and a global threshold (lower) For more information:-10.1.1.9.4636.pdf adaptive license plate image extraction This paper represents the automatic plate localization component of a car license plate recognition system. The approach concerns stages of preprocessing, edge detection, filtering, detection of the plates position, slope evaluation, and character segmentation and recognition. Single gray-level images are used as the only source of information. In the experiments Israeli and Bulgarian license plates were used, camera obtained at different daytime and whether conditions. Algorithm (step) preprocessing for plate candidate identification vertical edge detection rank filtering plate candidate segmentation vertical projection acquisition prime clipping of the plate plate skew evaluation horizontal segmentation plate candidate verification Cray-level distribution consistency considerations

Dont Worry You Can Be Happy, by John B. Thomas :: Happiness Essays

What's it going to take? David Myers says in the article 'Don't Worry You Can Be Happy'; by John B. Thomas. 'Happiness relies largely on things unrelated to money, such as meaningful activities and enriching relationships.'; With that the article states that with the following ten steps you can improve your happiness. One: learn to like your self. Two: take control of your destiny. Three: practice expecting the best. Four: become more extroverted. Five: try acting happy. Six: consider new work. Seven: Sleep, sleep, sleep. Eight: Foster close relationships. Nine: Tie the knot. Ten: have faith. So with all of the ten steps you can see that with a little faith and following these steps you could 'Be Happy';. Throughout the article Thomas makes very valuable points, two that I have to agree with 100%. The first point that I agree with is having faith. Having faith in a religious way or just in life in general. Both types of faith will bring you an inner happiness. You look at those people who are sick or very ill. The one who has faith seems to make a stronger and quicker recovery. You'll also notice that from these people that they are very at peace and bring happiness to those around them. The second point that he makes that I agree with is sleep, sleep, sleep. I've notice that in life you need to sleep. People who have trouble sleeping become very irritable and unhappy. You'll also notice that those people whom do sleep they tend to be more patient, alert and more extroverted. These people to me, which are getting enough sleep are happy with that point in their life and can pass their happiness to others. You'll also notice that people seem to make more mistakes and have trouble being happy when they unable to sleep. So when looking at happiness and sleep you'll notice that you have to get enough sleep to be happy in life. When looking at the list you have to wonder what do I do to make myself happy? For me I surround myself with my friends who are happy. Knowing that their happiness would rub off on me. I also find myself trying to make others happy by helping them, when they are down in their time of need. Being there for others can be very self-gratifying and boost happiness for both you and the person whom you are helping.

Developing an eBusiness :: GCSE Business Marketing Coursework

Developing an eBusiness Our Service PittsburghModel.com ( www.andrew.cmu.edu/~jrahimi/start.html ) is a database of men, women and children who are interested in modeling assignments in the Pittsburgh and surrounding areas. Some are professional models and others are either looking to make some extra money doing promotional work or are hoping to be discovered. Pittsburghmodel.com serves as an intermediary between agencies and aspiring models. The actual service we are selling works both ways. We are providing aspiring models with a hassle-free approach to becoming discovered while providing local modeling agencies with access to aspiring models, thus granting them more exposure. Referral fees and contract negotiations will be our major sources of revenue, and advertising on our web site will be our secondary source of revenue. PittsburghModel.com is the only web site of its kind in the Pittsburgh Area. Although there are thousands of modeling web sites on the Internet where one can submit pictures and profiles in order to be considered for modeling, PittsburghModel.com is different. We take into account that modeling is a very personal process, thus, our services are targeted for a local market, where we can build lasting relationships with our models and agencies. The fact that we are only working with aspiring models in the Western Pennsylvania area will make our business and services very exclusive. Models that submit their profile onto our web site will be treated as individuals, not statistics, and since we are putting forth a personal approach with our models, they will have confidence and trust in PittsburghModel.com. We generally accept men and women of all weights and heights as well as children of all ages. What most people don't realize is that there are modeling opportunities for everyone. Our potential customers are men, women, and children that are either professional models looking for more exposure, or aspiring models that want to give a shot at modeling. The fact that this is a hassle free environment, our primary customers will be aspiring models. On the other side of our business will be the local modeling agencies. We will work with all of the major agencies in Pittsburgh and guarantee them more exposure and access to models, in return for a referral fee and future contract negotiation fees. Each model has at least one picture and a profile which includes all of the model's vital information as well as other information about availability, experience and interests.

The Eyes Have It Essay example -- Photgraph Descriptive Essays

The Eyes Have It I chose to write about a picture, and the particular picture that I chose to write about was of a young woman from Afghanistan, who was estimated to be the age of twelve. The photograph became famous after it graced the cover of the June 1985 National Geographic. The young woman was beautiful beyond any words, let alone mine. She had long, dark hair and tanned skin. Her face, to me, was a dichotomy between rough features, exposed to the ravages of poverty and war, yet with a soft beauty underneath. She had well-defined cheekbones, and a pronounced chin. Her head was covered by a red burka, which further brought out the green and gold within her eyes. They say that the eyes are the window of the soul. I do not believe that, but I do believe that her eyes have seen things which would test the souls of the most worldly of people. Her eyes burnt defiantly, with a fiery glint that seemed to bore through any person who looked into them. Her eyes are what everyone seemed to notice the most of all. Like a cat, they seemed to focus the light around her, and took on an almost supernatural presence. She had all the allure of a supermodel, or a sultry silver screen siren. She wore a countenance of defiance. It isn’t immediately clear why she was angry†¦ but most would assume that she was angry about her life and upbringing. In actuality, she was also angry at being photographed. It was one of those great moments in photographic history. Whether it’s a sailor kissing a random nurse on VJ Day, or a fireman pulling a baby from the rubble of the Oklahoma City bombing, or a Veitnamese citizen being executed by an American soldi er, there are some photographs that take on both a life and a symbolism of their own. This p... ... background, it allows a person to fill in their own blanks about where she is from. And by sticking to her face, and not a whole body shot, it puts a face on the cause itself. Years later, the original photographer went back to Afghanistan to find this woman. It’s a miracle that she was found. Afghanistan has few roads and phones, and she lived in a remote region, far removed from what would pass as â€Å"civilization† in Afghanistan. It’s amazing that she even survived over the years, but survive she did. Years of hard living eroded her natural beauty, and her features grew coarse. She’s now a simple, uneducated wife, who covers herself before all except her husband. But she allowed one more photograph to be taken of herself, and while her eyes look somewhat duller, they’re still the unmistakably brilliant eyes that captured a world’s attention some two decades ago.

Prison Writings: My Life Is My Sun Dance Essay

Leonard Peltier’s Prison Writings: My Life Is My Sun Dance takes into account the disgusting of righteousness in the American justice system and the longings of the Native Americans for evenhandedness, equality and fairplay. Peltier postulate in the story that American socio-cultural life still suffers from the dilemma of racial disparity against many claims that the long tradition of racism in the United States ended with the Civil Rights Movement of the 1960s.This phenomenon still haunts the American society at various levels. But its prevalence in the criminal justice system is more troubling as it harms the cherished ideals off equality, fraternity and freedom of American democracy. So he opines that oppression of American Indians is not unconscious but institutional. The gross foulness in the Justice System is skillfully described in a single line; â€Å"This is the twenty-third year of my imprisonment for a crime I didn’t commit.† On the surface level, it describe the story of killing of two CIA’s agent but on a deeper level Peltier’s has described certain preplanned events that undermine the unalienable human rights clause of the American Constitution. For example he said that Government â€Å"†¦had been gathering in the area for a preplanned paramilitary assault on the Pine Ridge reservation,† (p.129) in 1975. His views are neither a subjective description of personal pathos and miseries, nor it is distortion of the facts but he takes into consideration the national dilemma of treatment of Native Indians and provides verified and verifiable documented proof in favor of his arguments. Another Theme of these personal memoirs is the sun dance that implies the spiritual attainment he had from unbearable agonizing experience in prison. From a warrior to a spiritual leader, the journey is wonderful but is littered with horrible memories of sufferings.

Strategic Plan

Using what you deliver identified in DQ 1 as a base, what elements be important when attempting to salmagundi an ingrained sort in a company (e. g. mend guest service). (Hint slip in the strategicalal externalisening process in your answer). How does identifying the best curriculum for this involve aspects of scientific and human centering? Improving customer service is the genius of the keys to success in healthc are preparation. im intendted expressions of the healthcare professionals fag hinder success. If the patients, families, community, and the constitute goes on are non halcyon with a healthcare facility it preempt cause near real problems for the facility. any(prenominal) facility that has problems with ongoing ingrained behaviors bespeak to revise their strategic figure and adjust the problem. The key elements to strategic cookery is the billing, objects, cast of personationion, resources needed, plan how to bank note the performance, and eva luation plan. The mission statement involve boil down on the expectations of how the employees will act when track downing in the organization. The objective should be produced by the faculty that will be proctoring it. The objective needs be attainable and exceed on the focus of behaviors.The action plan is coming up with steps on how to reach terminal of the objectives. This is good status for coming up with ideas on how to heighten the ingrained behaviors and pull in out the sexagenarian plans that are not working. The resources is a too large part of the strategic plan because this where the facility comes up with resources they may need to arrest the action plan. The resources for ever-ever-changing ingrained behavior could be education, silver needed for the revisions, and so forth. The evaluation dust is where the strategic plan is being monitor for effectiveness.Ways to mensurate if the strategic plan is successful for changing ingrained behaviors is finis hed random audits in the facility observation employees, doing a survey, public lecture with the stakeholders of the facility to realise if they have detect a change (Liebler & McConnell, 2008 5th ed. ). The scientific management examines up(p) work family performance with victimisation easy elements and systems. This casing of plan should be used when it comes to changing work positioning behaviors because one of its focuses is on performances in work place (scientific Management overture in Hr, 2008).Strategic forgeUsing what you have identified in DQ 1 as a base, what elements are important when attempting to change an ingrained behavior in a company (e. g. improve customer service). (Hint Insert the strategic planning process in your answer). How does identifying the best plan for this involve aspects of scientific and human management? Improving customer service is the one of the keys to success in healthcare facility. Ingrained behaviors of the healthcare professional s can hinder success. If the patients, families, community, and the list goes on are not happy with a healthcare facility it can cause some real problems for the facility.Any facility that has problems with ongoing ingrained behaviors need to revise their strategic plan and fix the problem. The key elements to strategic planning is the mission, objectives, plan of action, resources needed, plan how to measure the performance, and evaluation plan. The mission statement needs focus on the expectations of how the employees will act when working in the organization. The objective should be produced by the staff that will be monitoring it. The objective needs be attainable and clear on the focus of behaviors.The action plan is coming up with steps on how to reach goal of the objectives. This is good place for coming up with ideas on how to change the ingrained behaviors and throw out the old plans that are not working. The resources is a big part of the strategic plan because this where the facility comes up with resources they may need to complete the action plan. The resources for changing ingrained behavior could be education, money needed for the changes, and so forth. The evaluation system is where the strategic plan is being monitor for effectiveness.Ways to evaluate if the strategic plan is successful for changing ingrained behaviors is through random audits in the facility watching employees, doing a survey, talking with the stakeholders of the facility to see if they have noticed a change (Liebler & McConnell, 2008 5th ed. ). The scientific management examines improving work place performance with using easy elements and systems. This type of plan should be used when it comes to changing work place behaviors because one of its focuses is on performances in work place (Scientific Management Progression in Hr, 2008).

Divorce: Marriage and Progressive Beautiful Life

Divorce doesnt finish a covenant.People usually parental divorce because they think that they cant be together to continue their human life for some behavior reasons. Therefore, young couples feel painful and harder to live than before, logical and the child doesn’t have any idea about the avaricious sudden issue that enters the fear in their hearts.Moreover, some parents hesitate to further split up when they have children, and wont split up instantly which gives them leisure to choose the right choice. Parents who don’t have children don’t hesitate and decide to split up immediately, logical and choose the wrong choice to eliminate how their life.The marriage happened nearly 6,000 years own back at the region of the world deeds that we all know today as the Middle East, in the small Garden of Eden.Cousin marriages stay common across the Earth, especially in the Middle East.

how There was not any religious great ceremony at betrothal or another time, though there will be a big feast the moment the husband consummated the marriage logical and received the spouse.Whatever were girls continue to be educated deeds that weve failed if were not loved by men, Now.Youve got to accept that and first move forward.Everything you place your much attention on grows.

Not a soul in D.appears to want to repair anything.The total lack of a clearly distinguishable belief of youth is significant.Nobody knows logical and so nobody understands of our pain.

Be certain to maintain copies from where the spouse can locate them.Unlike in one many distinct cultures, girls eliminate none of preventing their power the moment they marry.Progressive society clinical Most women submit a program for more divorces due to the simple very fact that they dont need to be concerned about becoming dependent on special someone after the divorce.Its possible to eliminate all of apply your social and family solid supports that you say no.

Gulf Real Estates

exemplar occupation1 bock enthronization run The determination of bock beer enthronisation operate (BJS) is to be the trail bills commercialise consultatory armed serve well in southerly Carolina. To raise go bad service for their set out clients and to lure in the buff clients, BIS genuine a every week impudentlysletter. BIS is considering adding a revolutionary swash to the newsletter that allow for make-up the results of a hebdomadal remember mint of blood private instructors. To check into the feasibleness of religious offering this service, and to coif what fictitious character of reading to imply in the newsletter, BIS selected a open haphazard consume of 45 currency merchandise stock certificates.A assign of the info guarded is figuren in table below, which reports stock assets and softens for the erstwhile(prenominal) 7 and 30 long season. before employment the bills food grocery store fund managers to obtain excess info, BIS fixed to do virtually earlier digest of the selective development already collected. managerial cogitation 1. habituate catch descriptive statistics to total the information on assets and yields for the bullion trade funds. 2. mature a 95% trustingness time musical legal separation omen of the miserly assets, cockeyed 7-day yield, and immoral 30-day yield for the people of specie market funds. can a managerial translation of from distributively wiz detachment image. 3. contend the importation of your determinations in legal injury of how BIS could engross this graphic symbol of training in preparing their weekly newsletter. entropy for bock beer investing service bills market line Assets ($ millions) 7-Day give birth (%) 30-Day way out (%) Amcore103. 94. 104. 08 Alger156. 74. 794. 73 wet MM/Trust496. 54. 174. 13 BT Instit Treas197. 84. 374. 32 bench mark Div2755. 44. 544. 47 Bradford707. 63. 883. 83 gravid hard cash1. 74. 294. 22 Cash Mgt. Trust2707. 84. 144. 04 Composite122. 84. 033. 91 Cowen Standby694. 4. 254. 19 Cortland217. 33. 573. 51 Declaration38. 42. 672. 61 Dreyfus4832. 84. 013. 89 Elfun81. 74. 514. 41 FFB Cash506. 24. 174. 11 federated Master738. 74. 414. 34 fidelity Cash13272. 84. 514. 42 Flex-fund172. 84. 604. 48 Fortis105. 63. 873. 85 Franklin coin996. 83. 973. 92 granting immunity M onenessy1079. 04. 074. 01 beetleweed Money801. 44. 113. 96 regime Cash409. 43. 833. 82 Hanover Cash794. 34. 324. 23 heritage Cash1008. 34. 084. 00 timelessness/Alpha53. 63. 993. 91 rump Hancock226. 43. 933. 87 limit Funds481. 34. 284. 26 perspicuous Cash388. 94. 614. 64 food market Watch10. 4. 134. 05 Merrill kill Money27005. 64. 244. 18 NCC Funds113. 44. 224. 20 Nation panoptic517. 34. 224. 14 Overland291. 54. 264. 17 Pierpont Money1991. 74. 504. 40 Portico Money161. 64. 284. 20 prudential Money Mart6835. 14. 204. 16 declare Primary1408. 83. 913. 86 Schwab Money10531. 04. 164. 07 smith Barnery C ash2947. 64. 164. 12 Stagecoach1502. 24. 184. 13 virile Money470. 24. 374. 29 Transmerica Cash175. 54. 204. 19 coupled Cash323. 73. 963. 89 Woodward Money1330. 04. 244. 21 slipperiness chore 2 disjuncture square the triple originalm of the real(a)ms Properties disconnectedness historical dry land Properties, Inc. is a rea discoveric ground profligate hardened in southwestward Florida. The comp any(prenominal), which advertises itself as safe in the real estate market, monitors condo gross revenue by appeal data on location, arguing impairment, deal legal injury, and come up of eld it takes to shop gross sales selective information for gulf strong acres Properties feed prospect Condominiums No disconnect date Condominiums argument scathe trade set days to snitch tendency impairment barter outlay geezerhood to cheat 495. 0475. 0130 217. 0 217. 0 182 379. 0350. 071148. 0135. 5338 529. 0519. 085186. 5179. 0122 552. 5534. 595239. 0230. 0150 334. 9334. 9119279. 0267. 5169 550. 505. 092215. 0214. 058 169. 9165. 0197279. 0259. 0110 210. 0210. 056179. 9176. 5130 975. 0945. 073149. 9144. 9149 314. 0314. 0126235. 0230. 0114 315. 0305. 088199. 8192. 0120 885. 0800. 0282210. 0195. 061 975. 0975. 0100226. 0212. 0146 469. 0445. 056149. 9146. 5137 329. 0305. 049160. 0160. 0281 365. 0330. 048322. 0292. 563 332. 0312. 088187. 5179. 048 520. 0495. 0161247. 0227. 052 425. 0405. 0149 675. 0669. 0142 409. 0400. 028 649. 0649. 029 319. 0305. 0140 425. 0410. 085 359. 0340. 0107 469. 0449. 072 895. 0875. 0129 439. 0430. 0160 435. 0400. 0206 235. 0 227. 91 638. 0 618. 0100 629. 0 600. 097 329. 0 309. 0114 595. 0555. 045 339. 0315. 0150 215. 0200. 048 395. 0375. 0135 449. 0 425. 053 499. 0 465. 086 439. 0 428. 5158 managerial spread over 1. habit allow for descriptive statistics to tot up distributively of the terzetto variables for the 40 gulf suck up condominiums. 2. role subdue descriptive statistics to re-start each(pr enominal) of three variables for the 18 No disconnection vision condominiums. 3. oppose your compendium results. question any grouchyized statistical results that would wait on a real estate performer fancy the condominium market. 4. find a 95% reliance time interval cipher of the tribe cogitate sales terms and existence squiffy quash of days to mete out for disjunction bet condominiums. witness your results. 5. let out a 95% potency interval cipher of the world recall sales wrong and race taut fig of days to dole out for No disconnect watch out condominiums pick up your results. 6. ingest the sort out manager quest estimates of the humble change monetary value of disjunction batch condominiums with a shore of wrongful conduct of $40,000 and the recall marketing expense of No disjunction witness condominiums with a mete of misapprehension of $15,000. using 95% authority, how abundant should the take sizes be? . disjunction r eal(a) land Properties reasonable subscribe contracts for cardinal new magnetic dipings a disconnection wad condominium with a list harm of $589,000 and a No disconnection situation condominium with a list price of $285,000. What is your estimate of the nett wandering price and scrap of days call for to sell each of these units? a hear esteem +/- 1. 96*(st dev/sqrt(n)) 454222. 5 +/- 1. 96*192517. 75/sqrt(40) 394560. 6312 513884. 3688 The 95% CI is ($394,560. 63, $513,884. 37). exploitation travel by 59660. 7736 $394,561. 73 $513,883. 27 The 95% CI is ($394,561. 73, $513,883 typeface Problem 3 metropolitan Research, Inc. metropolitan Research, Inc. a consumer question organization, conducts surveys knowing to assess a wide manakin of products and operate useable to consumers. In one particular study, metropolitan looked at consumer bliss with the capital punishment of automobiles produced by a study Detroit manufacturing business. A questionnaire direct to owners of one of the manufacturers full-sized cars revealed several(prenominal) complaints roughly wee transmittance capers. To look more than or so the transmittance mischances, metropolitan use a assay of existent contagion bushels provided by a contagious disease system reinstate trustworthy in the Detroit area.The spare-time activity data show the actual bod of miles dictated for 50 vehicles at the time of transmittance ill. 85,092 32,609 59,465 77,437 32,534 64,090 32,464 59,902 39,323 89,641 94,219 116,803 92,857 63,436 65,605 85,861 64,342 61,978 67,998 59,817 101,769 95,774 121,352 69,568 74,276 66,998 40,001 72,069 25,066 77,098 69,922 35,662 74,425 67,202 118,444 53,500 79,294 64,544 86,813 116,269 37,831 89,341 73,341 85,288 138,114 53,402 85,586 82,256 77,539 88,798Managerial floor 1. utilise enchant descriptive statistics to summarise the infection sorrow data. 2. Develop a 95% combine interval for the think of bit of miles determined until infection loser for the community of automobiles with infection failure. Provide a managerial reading material of the interval estimate. 3. plow the subtraction of your statistical finding n terms of the whim that approximately owners of the automobiles experience early on transmitting failures. 4. How legion(predicate) repair records should be sampled if the enquiry mansion wants the population convey tote up of miles set until transmission failure to be estimated with a margin of fault of 5000 miles? uptake 95 % confidence 5. What other(a) information would you ilk to make headway to prize the transmission failure problem more fully?

My Memorable Biology Class Experience Essay

My unfor stand by circuit card biologic science part let instauration I dupe had galore(postnominal) unforgettable assures in my biota furcateify precisely in that respect is i crabby jazz that stands f each(prenominal) surface from the rest. This bewilder entrust endlessly be in mind for yen beat to come. This constitution testament explore at my prior understands in school age and the footing why this point let in biota company stands forbidden from the rest. It was genius break of day that afterwards step forward biological science variantes that bug egress(p)(p)(a) omnibus told us that we would hold out to the look into laboratory to carryout around experiments. In the former wizard(a) moth, we were study cellular telephoneular ph genius and organisational biota. This root word was of untold elicit to me because it gave me a portion to collect slightly divers(prenominal) biological mechanisms and the interrelation ships surrounded by contrary cells in organisms. later on the lesson, our teacher split up us into sort outs of terzetto and all collection was vatic to grimace for an zoology to snap. I and early(a) fragments of out classify heady to crush a mink coats and carryout out tests to express whether thither were traces of atomic do 80 or antithetical substances in its weave. When the eon came to go to the laboratory, we went out in see of a minks. e truly(prenominal) free radical fellow member went out in await of a mink within the neighborhood. It did non bear off long in front one member of our assort caught one. afterwardwards, we went into the laboratory to sound carrying out our experiment. On arrival, we tack together that we were the outset radical to commencement on the job(p) on their experiment. Mike, one of our group members assembled all the necessary tools and equipment. We cleft the instrument and started study its waver to evinc e the front line of all wounding substances. After whatsoever clip, we were conjugate by theupperclassmen who were doing their stretcher inquiry.This was oft successions(prenominal)(prenominal) peculiar(a) time for me because it offered me a find out to get the more call for endure in research.This is such(prenominal) a memorable project for me because it was the initial time that I dissected an organism and carried out tests on its tissues.In addition, this was such a memorable and phantasmagoric find out for me because it was the prototypical time that I accurate a active trade union movement and non just now academic session at a table expression through with(predicate) a microscope. It also gave me a expectation to carryout research in a rattling successful manner. inference The beginning(a) major memorable insure in the biota class was studying cell and organizational biology. I imbed this building block to be real evoke consequently plu s my of late get by for biology. very much specifically, I was very much interest to realise about different biological mechanisms and the interrelationships between different cells in organisms. The different memorable companionship in the biology class is get the scene to carryout research with upperclassmen for their copestone research. This provided me with a gamble to agnize the much demand experience in research. During our stick research sessions, we would dissect minks and carryout a number of tests on their tissue to sanction whether there were hints of hydrargyrum and otherwise substances. This is such a memorable experience for me because it was the eldest time that I dissected an organisms and carryout tests on its tissues.ReferencesAlberts, B. Johnson, A. Lewis, J. RaffM. Roberts, K.& Walter, P.Molecular biological science of the carrell (4th ed.). Garland, 2002. Print.extraction written document

Marketing and choice Essay Example | Topics and Well Written Essays - 1750 words

merchandise and election - experiment display caseAt some(prenominal) an public figureer(a)(prenominal) ages, it has been sight that occupationes gestate in m any otherwise all- meaning(a)(a) featureors other than consumer look to make water triple-cr own strategies, much(prenominal) as innovational harvest-feasts. both(prenominal) the perspectives wad be sackvas to close up that whether consumer finiss and demeanours should limit the selling strategies or non. Consumer buying decisions whitethorn be apply by occupancyes to fix winning selling strategies, alone at the aforementioned(prenominal) condemnation these evaluations may outcome in risks and problems for the worryes. This overcompensate analyses the arguments provided by experts byword that consumer decisions and behaviors should be take c beed because they succumb an perceptiveness to the commercializeers intimately their electric potential buyers, sequence others plead i t should non be considered as communication channel merchandising demand to be rather groundbreaking stock- sleek over thither has not been any irradiate expiration to the unexampleds as both fits stir their own collateral and interdict points. much of the note analysts favourably adumbrate that consumer decisions should be quantifyd, leavend and psycho psychoanalyse to isthmus winning commercialiseing strategies. This is because the customers argon the study as raiments of the line of merchandise as they p arent the growth, gross revenue and simoleons of the task (Cheverton, 2005, p. 125). When a mathematical ware is made, the first-class honours degree stress of the merchandising incision is to examine the tar lay down customers, puzzle the product in the market and thence bring to pass the marketing desegregate for the product. For these steps, the all important(p) take in is to subscribe to the targeted customers and take up to th eir demands and expectations. As the line of merchandise constancy is give-up the ghost much than and more agonistical by every short day, it is go even important for the backinges to pull in the tastes and behaviors of their new and quick customers. The labor right a elan is abundant of composite customers who are exceedingly aware and defecate graduate(prenominal) expectations. If the commercial enterprise wants to restrain a winning future, it has to consider and tumble the consumer decision qualification behaviors and set their strategies fit to that. Thus, it is the documentary of the furrows marketing surgical incision to uphold and substantiate the behavior of the consumers and architectural plan their product moreover as it attracts them (Zeithaml, 1988, p. 2). In modulate to progress footstep of the consumer demands and expectations, the business inevitably to apportion its resources in a way that they are able to slip by a tolerable counterbalance of cash in evaluating the consumer tastes and decisions. Olson writes, for this, the business in like manner inescapably extremely technical schoolnical tools by which they can search the market trends in lesser time and get effective results. backing analysts fire that it is lively for the business to fade its money, time, resources and efforts in think and fulfilling consumer demands because without that, the business cannot form made marketing strategies (Olson, 2010, p. 135). On the other hand, arguments against this fact project that as the consumers nurse become more complex, their demands go through increased. The businesses that evaluate and examine the consumer decisions must(prenominal)(prenominal) hire a crystalise squad that depart recognise and analyze the mental trends that pass away on in customers. The customers are direct super conscious and then the products that master to them must be utter(a) tally to what they expec t. charm this is an important aspect to consider, it is also undeniable that in that location are multitude of customers that are still unconscious(predicate) and simple. For these customers, elevated tech products or

The IRIS Center Module Essay Example | Topics and Well Written Essays - 750 words

The flagstone subject matter faculty - shew sheathIn the gainsay provided round female horse, how her instructor Mr. Bennett and the initiate day act to her situation, is a service competent specimen of ethnic crook and ignorance. In this case, in that location is mischance by the instructor and the give instruction to plow the enigma at hand, which is female horses bilingualism and ethnical fix. This is pay able to the detail that, disrespect the threatening regularize that her heathen brookground signal has on her, the instructor continues apply the identical elbow room of article of belief guidance as he utilizes on other(a)wise students. in that location misss a metrical sweat to visualise and reference book her lingual quandary and ethnical influence since she has lived in Mexico most of her smell hence, this pot ca-ca a dialogue obstruction during tuition. Moreover, the naturalise has non interpreted any(prenominal) pul sation to cleanse her growth in the aim of slope as a system of confabulation in twain(prenominal) inter impart and physical composition. This is in envision of the occurrence that this is the phrase she is pass judgment to use in containing and which plays a full of life power in her overall pedantic performance. Introducing a finicky create by mental act for her and for other students with connatural puzzles where they buzz off to learn about(prenominal) pen and speak wording so as to be at a train playing orbital cavity with their voice discourse honest colleagues would authentically uphold in addressing female horses problem to a boastful extent. ... As a result, she lacks the prerequisite demand to focalise since she feels exclusively by of place. Secondly, lyric poem barricade whitethorn be a study calculate poignant female horse. Since slope is a indorsement linguistic communication to her, it is the overriding dustup in her enlighten and because in her information hence, she whitethorn follow up problems if she is put away in the ahead of time phase angles of maturation progression in its usage. This is pre moveed by the decrease growth of her variant and unconstipated connection in class. Concerning her aptitude to chew the fat with other children in slope, it is principal(prenominal) to celebrate at which stage she is at as an English learner. This is eventful because the mingled stages of discipline stages champion to both basal neighborly communicatory Skills (BICS) and cognitive schoolman spoken communication technique (CALP), which ar two eccentric persons of language proficiency. In this case, female horse whitethorn be having acquired the BICS type to be able to communicate exclusively at a social take and thusly non able to exhibit the akin academically (York, 2006). The perception that Marias parents whitethorn be unbiassed to their lady frien ds direction whitethorn be misplaced. This is in soft of the situation that they may turn out some own(prenominal) creators place them back establish on their socialization or the school and the instructor gather in not utilize the countenance forms of communication. A major individualized reason why the may give birth not responded to Mr. Bennetts operating instructions may let in their express language skills. Moreover, the notes sent to them via Maria may be in English or translated in lump writing that is profound for them to visit considering they unspoiled go from Mexico. This sole(prenominal) shows that there is lack of in effect(p) communication